Y at a 1:2500 dilution. After incubation with the antibody, the membranes
Y at a 1:2500 dilution. After incubation with the antibody, the membranes were washed three times with PBST for 10 min each and then immersed in an ECL solution (combining solutions A and B of the ECL kit in a 1:1 ratio) with agitation for 1 min. After washing, the blots were developed by ECL.Quantitative real-time reverse-transcriptase polymerase chain reaction (qRT-PCR)Aurora B and MSK1 are thought to be involved in chromatin organization, gene expression, and carcinogenesis [14,15]. More than 20 compounds with cytotoxic effects were screened, and we found a compound, squamocin, isolated from several genera of the plant family Annonaceae, which decreased (m)RNA MG-132 cost expression levels of aurora B and MSK1 in cancer cells. The expressions of aurora B and MSK1 were significantly downregulated in squamocin-treated GBM8401, Huh-7, and SW620 cells compared to the control (Figure 2). Similarly, squamocin treatment decreased PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28667899 the protein expression levels of aurora B and phosphorylated MSK1 (pMSK1) (Figure 3). These results imply that squamocin regulates aurora B and MSK1 activities at the transcriptional and translation levels.Squamocin downregulated phosphorylation levels of histone H3 at Ser10 and SerRNA was isolated from cultured cells, and the analysis was performed as previously described [18]. The PCR was performed in a final volume of 20 l using a LightCycler instrument (Roche Diagnostics) according to the manufacturer’s recommendations. The amounts of complementary (c)DNA were normalized to the housekeeping gene, GAPDH, to calculate the relative expressions of aurora B and MSK1 RNA (Table 1). Primers used to detect these genes were designed using ProbeFinder software http:// www.roche.com and were synthesized by custom oligonucleotide synthesis (Genomics, Taipei, Taiwan). The qRTPCR cycling parameters were set as follows: 40 cycles of 95 for 10 s (denaturation), followed by 60 for 30 s (annealing), and 72 for 1 s (extension).Statistical analysisIn eukaryotes, aurora B and MSK1 are linked to the phosphorylation of H3S10 and H3S28 [7-9]. In order to investigate the effects of squamocin on H3S10p and H3S28p, cells were treated with squamocin for 24 h, and the protein expression levels were analyzed by Western blotting. The results showed that decreased H3S10p and H3S28p protein expression levels were detected in squamocin-treated cells (Figure 3). Our experiment revealed that squamocin treatment decreased phosphorylation of histone H3S10 and H3S28, as well as caused declines in the protein and RNA expression levels of aurora B and pMSK1. The modulation of H3S10 and H3S28 phosphorylation by aurora B and/or pMSK1 indicates that squamocin probably decreased the phosphorylation of H3S10 and H3S28 by downregulating aurora B and pMSK1 in cancer cells.Effects of squamocin on cell viabilityResults from multiple experiments are expressed as the mean ?standard error. The difference between the treatment and control groups was analyzed by Student’s t-test. A probability (p) value of < 0.05 was considered significant.Table 1 Information about the primers and probes used in qRT-PCRGene aurora B GAPDH MSK1 Forward primer attgctgacttcggctggt agccacatcgctcagacac tggtgctgacagattttggt Reverse primer gtccagggtgccacacat gcccaatacgaccaaatcc caaaaggaatatgctctttcagtttc Probe 69 60The growth-inhibitory activity of squamocin was assessed by an MTT assay. GBM8401, Huh-7, and SW620 cells were treated with different concentrations (15 120 M) of squamocin for 24 h. Th.
