A TaqMan hydrolysis probe (amplicon covering part of exon 6 and 7). Expression was normalized to that of Tbp or Gapdh depending on the employed strategy (SYBR green or TaqMan probe, respectively) and represented as relative to that of wild type animals. Panels A and B: qPCR and Western analysis of the LTR9S allele. Only +/+ and +/LTR9S animals are included since LTR9S/LTR9S animal die within three weeks. Panels C and D: qPCR and Western Blot analysis of the LTR9AS allele. Paired Student’s t test was used to determine p-values relative to +/+ animals. doi:10.1371/journal.pone.AZP-531 0056029.gLTR-Mediated Nras DeregulationLTR-Mediated Nras DeregulationFigure 6. Analysis of knock-in animals harboring the LTR inserted at position 3. Nras expression was quantified by qPCR employing an amplicon employing two different methods, SYBR green (amplicon covering part of exon 2 and 3) or a TaqMan hydrolysis probe (amplicon covering part of exon 6 and 7). Expression was normalized to that of Tbp or Hprt depending on the employed strategy (SYBR green or TaqMan probe, respectively) and represented as relative 18325633 to that of wild type animals. N represents the number of animals in the different groups. Alleles with the cassette in sense (panel A) or antisense (panel B) orientation were analyzed. Paired Student’s t test was used to determine p-values relative to +/+ animals. doi:10.1371/journal.pone.0056029.gin somatic tissues such as promoter insertion, alternative splicing, enhancer insertion, activation of a cryptic promoter [18] [8] [19], and the formation of chimeric RNA initiated at AZP-531 biological activity retroviral antisense promoters [8]. This type of knock-in mice provides novel models for the analysis of phenotypic consequences of deregulation of target genes for retroviral insertional mutagenesis [9].Materials and Methods Knock-in, ES Cells, AnimalsHomology arms for the targeting vectors were retrieved by recombineering in bacteria [20]. Linearized targeting vector DNA was electroporated into CJ7 ES cells [21]. Successful targeting was verified by Southern blot and positive ES cell clones were injected into B6D2F2 blastocysts [22]. Chimeric mice were mated with C57Bl/6J, offspring was genotyped by PCR with primers flanking the individual insertion sites. In ES cells, the PGK-TN5-neo cassette was removed by transient transfection with an expression vector coding for Cre recombinase. In mice, the PGK-TN5-neo cassette was removed by mating knock-in mice with transgenic mice expressing Cre recombinase under the control of the EIIa promoter [23].For the N-terminal detection the Nras (Mm00477878_g1) taqman probe was used with the reference Gapdh (4352932E) or Hprt (Mm00446968_m1) probes used as internal standard. Cterminal detection of Nras was done with Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen) with primers for Nras: [5′ – ACTGGTCTCTCATGGCACTGTACT – 3′]; [5′ – TACAAACTGGTGGTGGTTGGAGCA – 3′] and primers for Tbp: [5′ -AGAGAGCCACGGACAACTG – 3′]; [5′ – ACTCTAGCATATTTTCTTGCTGCT – 3′]Rapid Amplification of cDNA EndsInitiation sites of alternative transcripts within the Nras gene or viral LTR were identified by the usage of the GeneRacerTM kit (Invitrogen). The sequential 59 dephosphorylation/decapping steps included in this kit ensure the ligation of a specific adaptor RNA oligonucleotide only to full-length (previously capped) mRNA, validating the identified sequences as putative initiation site and not artifacts originated by RNA truncation. cDNA synthesis was performed follo.A TaqMan hydrolysis probe (amplicon covering part of exon 6 and 7). Expression was normalized to that of Tbp or Gapdh depending on the employed strategy (SYBR green or TaqMan probe, respectively) and represented as relative to that of wild type animals. Panels A and B: qPCR and Western analysis of the LTR9S allele. Only +/+ and +/LTR9S animals are included since LTR9S/LTR9S animal die within three weeks. Panels C and D: qPCR and Western Blot analysis of the LTR9AS allele. Paired Student’s t test was used to determine p-values relative to +/+ animals. doi:10.1371/journal.pone.0056029.gLTR-Mediated Nras DeregulationLTR-Mediated Nras DeregulationFigure 6. Analysis of knock-in animals harboring the LTR inserted at position 3. Nras expression was quantified by qPCR employing an amplicon employing two different methods, SYBR green (amplicon covering part of exon 2 and 3) or a TaqMan hydrolysis probe (amplicon covering part of exon 6 and 7). Expression was normalized to that of Tbp or Hprt depending on the employed strategy (SYBR green or TaqMan probe, respectively) and represented as relative 18325633 to that of wild type animals. N represents the number of animals in the different groups. Alleles with the cassette in sense (panel A) or antisense (panel B) orientation were analyzed. Paired Student’s t test was used to determine p-values relative to +/+ animals. doi:10.1371/journal.pone.0056029.gin somatic tissues such as promoter insertion, alternative splicing, enhancer insertion, activation of a cryptic promoter [18] [8] [19], and the formation of chimeric RNA initiated at retroviral antisense promoters [8]. This type of knock-in mice provides novel models for the analysis of phenotypic consequences of deregulation of target genes for retroviral insertional mutagenesis [9].Materials and Methods Knock-in, ES Cells, AnimalsHomology arms for the targeting vectors were retrieved by recombineering in bacteria [20]. Linearized targeting vector DNA was electroporated into CJ7 ES cells [21]. Successful targeting was verified by Southern blot and positive ES cell clones were injected into B6D2F2 blastocysts [22]. Chimeric mice were mated with C57Bl/6J, offspring was genotyped by PCR with primers flanking the individual insertion sites. In ES cells, the PGK-TN5-neo cassette was removed by transient transfection with an expression vector coding for Cre recombinase. In mice, the PGK-TN5-neo cassette was removed by mating knock-in mice with transgenic mice expressing Cre recombinase under the control of the EIIa promoter [23].For the N-terminal detection the Nras (Mm00477878_g1) taqman probe was used with the reference Gapdh (4352932E) or Hprt (Mm00446968_m1) probes used as internal standard. Cterminal detection of Nras was done with Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen) with primers for Nras: [5′ – ACTGGTCTCTCATGGCACTGTACT – 3′]; [5′ – TACAAACTGGTGGTGGTTGGAGCA – 3′] and primers for Tbp: [5′ -AGAGAGCCACGGACAACTG – 3′]; [5′ – ACTCTAGCATATTTTCTTGCTGCT – 3′]Rapid Amplification of cDNA EndsInitiation sites of alternative transcripts within the Nras gene or viral LTR were identified by the usage of the GeneRacerTM kit (Invitrogen). The sequential 59 dephosphorylation/decapping steps included in this kit ensure the ligation of a specific adaptor RNA oligonucleotide only to full-length (previously capped) mRNA, validating the identified sequences as putative initiation site and not artifacts originated by RNA truncation. cDNA synthesis was performed follo.
